МУ 2.3.2.2789-10. 2.3.2. Продовольственное сырье и пищевые продукты. Методические указания по санитарно-эпидемиологической оценке безопасности и функционального потенциала пробиотических микроорганизмов, используемых для производства пищевых продуктов

Текст документа по состоянию на июль 2011 года


Утверждаю
Руководитель Федеральной
службы по надзору в сфере
защиты прав потребителей
и благополучия человека,
Главный государственный
санитарный врач
Российской Федерации
Г.Г.ОНИЩЕНКО
6 декабря 2010 года

Дата введения:
с момента утверждения



1. Авторский коллектив: Научно-исследовательский институт питания РАМН; Учреждение Российской академии наук Институт общей генетики им. Н.И. Вавилова РАН; ФГУН "Московский научно-исследовательский институт эпидемиологии и микробиологии им. Габричевского" Роспотребнадзора; ФГБУ Научно-исследовательский институт эпидемиологии и микробиологии им. почетного академика РАМН Н.Ф. Гамалеи Минздравсоцразвития России; ГОУ ВПО Тверская государственная медицинская академия "Федерального агентства по здравоохранению и социальному развитию Российской Федерации"; Московский государственный университет им. М.В. Ломоносова; при участии ВНИМИ РАСХН, ООО "Бактотех".

2. Рекомендованы Комиссией по государственному санитарно-эпидемиологическому нормированию при Федеральной службе по надзору в сфере защиты прав потребителей и благополучия человека (протокол от 14.10.2010 N 2).

3. Утверждены Руководителем Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека, Главным государственным санитарным врачом Российской Федерации Г.Г. Онищенко 6 декабря 2010 г.

4. Введены в действие с момента утверждения.

5. Введены впервые.



Введение

Опыт широкого применения пробиотиков в пищевой промышленности в целом подтверждает историю безопасного употребления в пищу человека микроорганизмов-симбионтов кишечной микрофлоры, к которым относится большинство пробиотиков, и отсутствие у них способности обусловливать у потребителей заболевания инфекционного и инвазионного характера. В то же время, как признают эксперты ФАО-ВОЗ, пробиотики потенциально могут быть ответственны за ряд побочных эффектов (септические инфекции, избыточная метаболическая активность, гиперстимуляция факторов локального иммунитета, передача генов представителям нормофлоры организма человека). Наибольшую актуальность в этом аспекте на сегодняшний день приобретает требование к контролю отсутствия у штаммов трансмиссивных генов, прежде всего антибиотикорезистентности.

Накопленные в области нутрициологии и микробиологии данные также свидетельствуют о штаммоспецифичности благоприятного воздействия пробиотиков на здоровье человека. В связи с этим согласно международным требованиям таксономическая принадлежность пробиотических штаммов должна устанавливаться с использованием современных воспроизводимых молекулярно-генетических методов. Подтверждение пробиотического потенциала стартерных культур пробиотиков должно быть основано на научной доказательной базе.

Настоящие методические указания разработаны с целью обеспечения единого научно обоснованного подхода к оценке качества и безопасности штаммов пробиотических микроорганизмов (далее - штаммов), предназначенных для производства пробиотических заквасок прямого внесения, бактериальных концентратов и микробной биомассы, являющейся компонентом пробиотических пищевых и биологически активных добавок, или используемых для обогащения традиционных пищевых продуктов и биологически активных добавок; совершенствования нормативной базы, регулирующей оборот продукции, выработанной с использованием живых пробиотических микроорганизмов.



1. Область применения

1.1. Методические указания устанавливают требования к микробиологической, биохимической, молекулярно-генетической и гигиенической оценке штаммов, используемых в качестве стартовых культур для изготовления пробиотических заквасок, включая закваски прямого внесения, бактериальных концентратов и микробной биомассы для производства пробиотических пищевых продуктов и биологически активных добавок к пище, и необходимые методы лабораторных исследований для ее осуществления.

1.2. Методические указания предназначены для юридических лиц и индивидуальных предпринимателей, деятельность которых связана с разработкой, производством и обращением биотехнологической продукции, а также для испытательных лабораторных центров, осуществляющих контроль качества и безопасности продовольственного сырья и пищевых продуктов и БАД к пище и аккредитованных в установленном порядке на данный вид деятельности.



2. Общие положения

2.1. Санитарно-эпидемиологическая оценка штаммов, отобранных по специфическим функциональным пробиотическим свойствам, включает в себя комплекс микробиологических, биохимических, молекулярно-генетических и гигиенических исследований для подтверждения их безопасности (безвредности), а также наличия у них свойств, обусловливающих пробиотический эффект в организме, и поэтому пригодных для создания пробиотических продуктов питания и биологически активных добавок к пище.

2.2. Положения, изложенные в настоящих методических указаниях, применяются при разработке технической документации на продукцию, а также на этапе предрегистрационных испытаний (исследований) впервые разрабатываемой или впервые ввозимой на территорию Российской Федерации продукции.

2.3. В составе пробиотических заквасочных культур, бактериальных концентратов и микробной биомассы для производства пробиотических пищевых продуктов и биологически активных добавок к пище, содержащих живые микроорганизмы, могут использоваться отдельные штаммы (или консорциумы штаммов), принадлежащие к родам бифидобактерий (Bifidobacterium spp.), лактобацилл (Lactobacillus spp.), пропионовокислых бактерий (Propionibacterium spp.) и др., за исключением родов и видов микроорганизмов, перечисленных в СанПиН 2.3.2.2567-09 "Дополнение 15 к СанПиН 2.3.2.1078-01 "Гигиенические требования безопасности и пищевой ценности пищевых продуктов".

2.4. Для обеспечения безопасности и пригодности пробиотических пищевых продуктов и биологически активных добавок к пище, содержащих живые микроорганизмы, штаммы для производства должны отвечать следующим требованиям:

2.4.1) должны быть преимущественно изолированы (без применения каких-либо биотехнологических воздействий на штамм) из представителей симбиотической резидентной микрофлоры желудочно-кишечного тракта здоровых людей. В иных случаях и в случаях, когда потенциальная пробиотическая культура изолирована из пищевого продукта, организма животного или другого объекта окружающей среды, наряду с происхождением штамма должен быть известен способ селекции (индуцированный мутагенез, адаптация к определенным факторам, генно-инженерные манипуляции, в том числе самоклонирование, и др.) этих микроорганизмов;

2.4.2) таксономическая принадлежность должна быть установлена до уровня штамма путем изучения широкого спектра фенотипических характеристик и подтверждена с использованием воспроизводимых молекулярно-генетических методов;

2.4.3) номенклатурное название штамма должно приводиться в соответствие с кодами современной международной классификации (по Approval Lists of Bacterial Names in International Journal of Systematic Bacteriology, 1980, v. 30, 225 - 420, http://www.bacterio.cici.fr/ или Validation Lists in the International Journal of Systematic and Evolutionary Microbiology) и включать обозначение рода, вида и штамма;

2.4.4) должны быть задепонированы в национальных или международных коллекциях микробных культур Российской Федерации на условиях контрольного хранения (для отечественных производителей - ВКПМ ФГУП ГосННИгенетика или ФГУН МНИИЭМ им. Г.Н. Габричевского, Москва; для зарубежных - международная коллекция микроорганизмов при ВКПМ ФГУП ГосННИгенетика), сопровождаться справкой о депонировании и паспортом штамма с указанием подробной таксономической характеристики, источника и даты выделения, анатомической области изоляции, присущих штамму фенотипических и генетических характеристик, в т.ч. наличия внехромосомного генетического материала. Форма паспорта на штамм и перечень включаемых в него характеристик приведены в Прилож. 1;

2.4.5) должны принадлежать к видам, имеющим документированную историю применения в пищу человеку, не должны обладать факторами патогенности, токсигенности и вызывать заболевания у людей и теплокровных животных;

2.4.6) должны иметь изученный профиль антибиотикорезистентности в отношении современных применяемых в медицине антибиотиков и не обладать антибиотикорезистентностью трансмиссивного типа;

2.4.7) должны иметь стабильные фенотипические, генотипические и технологические характеристики; иметь изученный профиль внехромосомных элементов (плазмид, транспозонов, бактериофагов и др.), при наличии внехромосомных элементов их функциональная роль должна быть охарактеризована и доказана неспособность к генному трансферу;

2.4.8) не должны обладать способностью к транслокации в лимфоузлы, паренхиматозные органы, кровь у человека и теплокровных животных, обладающих иммунодефицитностью;

2.4.9) не должны обладать способностью к иммуносупрессии или избыточной иммуностимуляции, а также генерации провоспалительного эффекта in vitro и in vivo;

2.4.10) не должны обладать способностью образовывать новые метаболические продукты или избыток известных продуктов в количествах, способных вызывать побочные эффекты;

2.4.11) не должны ингибировать рост представителей нормальной резидентной микрофлоры желудочно-кишечного тракта человека и теплокровных животных.

    2.5. Изучение штаммов по показателям, указанным в п. п. 2.4.5 - 2.4.11,
характеризующим  их безопасность, проводится путем тестирования in vitro и
в  экспериментах in vivo (на моделях конвенциональных линейных лабораторных
животных  обоего пола, обычно применяемых в нутрициологии, - мышах, крысах,
морских   свинках,   кроликах,   с   пероральным  введением  стандартных  и
                          11                                              9
аггравированных доз (до 10   КОЕ и более в 1 г  инокулята, но  не менее 10
КОЕ на животное)).

В необходимых случаях могут быть использованы животные-гнотобионты.

2.6. В случае использования генно-инженерно-модифицированных пробиотических штаммов оценка их безопасности проводится в соответствии с требованиями, включенными в МУ 2.3.2.1830-04 "Микробиологическая и молекулярно-генетическая оценка пищевой продукции, полученной с использованием генетически модифицированных микроорганизмов" и СанПиН 2.3.2.2340-08 "Дополнения и изменения 6 к СанПиН 2.3.2.1078-01 "Гигиенические требования безопасности и пищевой ценности пищевых продуктов".

2.7. Для штаммов зарубежного производства, впервые ввозимых на территорию Российской Федерации, в т.ч. в составе заквасок, пробиотических пищевых продуктов и биологически активных добавок к пище с живой микрофлорой, необходимо документальное подтверждение разрешения их использования в пищевой промышленности и/или в свободной продаже населению со стороны компетентных органов страны-изготовителя.

2.8. Потенциальные пробиотические штаммы должны быть охарактеризованы на наличие у них функциональных (пробиотических) свойств. Тестирование функциональных свойств должно совмещать скрининг in vitro с экспериментальной оценкой in vivo на животных, указанных в п. 2.5; в необходимых случаях должны предусматриваться клинические испытания выработанных с включением штаммов опытно-промышленных образцов пробиотических продуктов и БАД к пище.

2.8.1. У всех штаммов должна быть изучена выживаемость в проксимальных отделах ЖКТ и пролиферация в толстом кишечнике, устойчивость к действию кислотности желудка, желчи, адгезия к эпителиальным клеткам человека и клеточным культурам, антагонистическая активность против патогенных и условно-патогенных микроорганизмов - возбудителей острых кишечных инфекций и других инфекций с пищевым путем передачи, способность снижать их адгезию в кишечнике, способность к гидролизу желчных кислот.

2.8.2. В необходимых случаях штаммы должны быть охарактеризованы на способность к продукции биологически активных веществ и других факторов, обусловливающих пробиотический эффект (иммуно-пептидов, антимикробных веществ, в т.ч. бактериоцинов, органических кислот, в т.ч. короткоцепочечных жирных кислот, экзополисахаридов, профиль взаимодействия с клетками иммунной системы и модуляции цитокинов, расщепления холестерина, антиоксидантной активности и т.д.).

2.9. У потенциальных пробиотических штаммов должны быть охарактеризованы технологические характеристики.

2.9.1. Штаммы, отбираемые для заквасок, бакконцентратов или биомасс, должны сохранять жизнеспособность, генетическую стабильность, функциональные пробиотические характеристики на всех этапах производства, транспортировки и хранения, не сообщать продукту неудовлетворительных вкусов и запахов.

2.9.2. Штаммы, отбираемые для производства мультипробиотических консорциумов, многокомпонентных продуктов, включающих ингредиенты с антимикробной активностью (эфирные масла, лекарственные растения, йод и его соединения, пищевые волокна-адсорбенты и др.), должны быть испытаны на совместимость и хранимоспособность в течение всего срока годности.

2.10. Все исследования и эксперименты на лабораторных животных проводятся по принципам доказательности (наличие контрольных штаммов и групп интактных животных, количество подопытных животных, достаточное для получения статистически значимых результатов).



3. Нормативные ссылки

3.1. Федеральный закон от 02.01.2000 N 29-ФЗ "О качестве и безопасности пищевых продуктов" (с изменениями и дополнениями).

3.2. Федеральный закон от 07.02.1992 N 2300-1 "О защите прав потребителей" (с изменениями и дополнениями).

3.3. Федеральный закон от 23.09.1992 N 3520-1 "О товарных знаках, знаках обслуживания и наименованиях мест происхождения товаров" (с изменениями и дополнениями).

3.4. Федеральный закон от 27.12.2002 N 184-ФЗ "О техническом регулировании" (с изменениями и дополнениями).

3.5. Федеральный закон от 12.06.2008 N 88-ФЗ "Технический регламент на молоко и молочную продукцию" (с изменениями и дополнениями).

3.6. Федеральный закон от 24.06.2008 N 90-ФЗ "Технический регламент на масложировую продукцию".

3.7. Постановление Правительства Российской Федерации от 22 ноября 2000 г. N 883 "Об организации и проведении мониторинга качества, безопасности пищевых продуктов и здоровья населения".

3.8. Постановление Правительства Российской Федерации от 21 декабря 2000 г. N 987 "О государственном надзоре и контроле в области обеспечения качества и безопасности пищевых продуктов".

3.9. Постановление Правительства РФ от 14.12.2009 N 1009 "О порядке совместного осуществления Министерством здравоохранения и социального развития Российской Федерации и Министерством сельского хозяйства Российской Федерации функций по нормативно-правовому регулированию в сфере контроля за качеством и безопасностью пищевых продуктов и по организации такого контроля".

3.10. СанПиН 2.3.2.1078-01 "Гигиенические требования к качеству и безопасности продовольственного сырья и пищевых продуктов" (с изменениями и дополнениями).

3.11. Единые санитарно-эпидемиологические и гигиенические требования к товарам, подлежащим санитарно-эпидемиологическому надзору (контролю) Таможенного союза ЕврАзЭС.

3.12. СП 1.3.2322-08 "Безопасность работы с микроорганизмами III - IV групп патогенности (опасности) и возбудителями паразитарных болезней".



4. Термины и определения

Пробиотические микроорганизмы - живые непатогенные, нетоксигенные микроорганизмы, представители защитных групп нормального кишечного микробиоценоза человека и природных симбиотических ассоциаций, благотворно влияющие на организм человека путем улучшения (оптимизации) состава и биологической активности микрофлоры его пищеварительного тракта.

Антагонизм - подавление жизнедеятельности одной микробной культуры (микробной популяции) другой за счет выделения в среду культивирования или совместного обитания веществ (антибиотиков, бактериоцинов, органических и жирных кислот), препятствующих росту или задерживающих размножение.

Симбиоз - благоприятное влияние друг на друга двух и более популяций микроорганизмов при совместном существовании путем улучшения условий своей жизнедеятельности.

Генно-инженерно-модифицированные микроорганизмы (ГММ) - бактерии, дрожжи, мицелиальные грибы, вирусы, в которых генетический материал изменен с использованием методов генной инженерии, то есть путем, который не имеет места в природе при размножении и/или при естественных рекомбинациях.

Антибиотикорезистентность трансмиссивная (трансферабельная) - устойчивость микроорганизмов к антибиотикам, закодированная на внехромосомных генных элементах микробной клетки, наиболее часто встречающийся селективный маркер рекомбинантной ДНК ГММ.

Пробиотические закваски прямого внесения - чистые культуры специально подобранных отдельных штаммов живых пробиотических микроорганизмов, а также смесей штаммов в питательных средах, использованных для их выращивания, либо суспензии вегетативных клеток (в т.ч. концентрированные) без или со средой культивирования, приготовленные на специализированных предприятиях и предназначенные для прямого внесения в подготовленное сырье непосредственно в резервуарах для производства пробиотического продукта. Пробиотические закваски прямого внесения могут выпускаться в сухом виде, в т.ч. лиофилизированном из замороженного состояния, или в жидком, в т.ч. замороженном.



5. Методы исследования таксономической принадлежности пробиотических штаммов

Таксономическая принадлежность штаммов устанавливается на основе полифазного таксономического подхода, использующего комплекс генотипических и ключевых фенотипических тестов, что позволяет с наибольшей степенью точности установить принадлежность микроорганизмов к таксону на уровне вида и штамма.

Разработчиком (поставщиком) должны быть предоставлены данные о сравнении фенотипических свойств штамма с характерными фенотипическими свойствами его вида, описанными в определителе Берги (Bergey's manual of systematic bacteriology. Eds. Sneaht P.N.D. et al. Baltimore; Williams and Wilkins, 1986, v. 2).

Исследования проводятся при использовании контрольных (референтных) штаммов данного вида из официальных депозитариев.

Результаты тестирования таксономической принадлежности по фенотипическим признакам одновременно могут использоваться для оценки штаммов в соответствии с требованиями п. 2.4 настоящих методических указаний.



5.1. Микробиологические исследования фенотипических свойств штаммов

На данном этапе идентификации определяются основные фенотипические признаки чистой культуры штамма: культуральные свойства колоний, морфология клеток в микроскопических препаратах (в живом и зафиксированном виде), отношение к окраске по Граму, способность к спорообразованию, а также каталазная и нитратредуцирующая активность при использовании общепринятых в микробиологии методов анализа.

Чистую культуру штамма выделяют на рекомендованной для данного вида микроорганизмов питательной среде, позволяющей получать изолированные колонии. Например, выделение чистой культуры лактобактерий должно осуществляться со среды MRS, термофильных стрептококков - со среды типа М17 по ГОСТ Р 51331-99, бифидобактерий - со среды Блаурокка, среды для бифидобактерий (г. Оболенск) или тиогликолевой среды.

Потенциальные пробиотические штаммы должны обладать типичными для рода культуральными признаками на всех типах сред (твердых, полужидких и жидких) без признаков диссоциации, а также однородными морфологическими, тинкториальными свойствами, окрашиваться по Граму положительно, не иметь спор и капсул, не восстанавливать нитраты, не продуцировать каталазу.



5.2. Биохимические исследования фенотипических свойств штаммов

Исследования проводятся для подтверждения принадлежности к роду и дифференциации видов. Оптимальными для данной цели являются методы идентификации микроорганизмов с помощью биохимических диагностических тест-панелей одноразового пользования отечественного и зарубежного производства, зарегистрированных в РФ в установленном порядке.

Для лактобактерий анализируется профиль ферментации расширенного набора углеводов и аминокислот (не менее 49 наименований).

Биохимическая идентификация бифидобактерий включает рутинную предварительную дифференциацию с определением их ферментативного профиля по укороченному спектру углеводов и многоатомных спиртов: лактоза, глюкоза, ксилоза, целлобиоза, рамноза, инулин, манноза, маннит, сорбит, инозит. С этой целью используют 1%-ные растворы десяти вышеперечисленных углеводов, приготовленные на основе полужидкой питательной среды (пептон - 10 г, кукурузный экстракт - 30 мл, цистин солянокислый - 0,2 г, хлористый натрий - 2,0 г, агар-агар - 0,75 г на 1 л дистиллированной воды и соответствующего индикатора pH).

    После  проверки  чистоты  культуры с помощью микроскопии  с поверхности
агаровой  пластины  снимают  выросшие  колонии  петлей  и  ресуспендируют в
стерильном  растворе  хлорида  натрия  для  получения  взвеси, содержащей 1
миллиард  клеток  бактерий  в 1 мл по стандарту мутности (ОСО 42-28-59-85).
Полученную  взвесь бактерий в количестве 0,01 мл вносят в 1 мл основы (т.е.
                                                  7
концентрация взвеси клеток в основе среды равна 10 ).

Растворы тестируемых углеводов и многоатомных спиртов вносят по 0,1 мл каждого в ряд лунок планшета для иммунологических исследований. В каждую из лунок затем добавляют по 0,1 мл взвеси испытуемой культуры бифидобактерий. В последнюю очередь в каждую лунку добавляют по 1 капле стерильного вазелинового масла. Для контроля среды в одну лунку помещают по 0,1 мл основы среды, по 0,1 мл взвеси испытуемой культуры и по 1 капле вазелинового масла. Для контроля жизнеспособности культуры во взвеси ее вносят в БС-среду.

Все посевы инкубируют при 37 °С в течение 24 ч в анаэробных условиях, после чего осуществляют предварительный учет результатов; окончательно результаты учитывают через 48 ч.

Результаты учитывают по изменению окраски среды в лунках: положительный результат - желтое окрашивание, отрицательный - фиолетовое.

Детальное изучение биохимических свойств штаммов, показавших положительные реакции с соответствующими субстратами, изучают при использовании параллельно трех биохимических тест-систем:

а) типа API-20CHL (bioMerieux, Франция);

б) типа API-50CHL (bioMerieux, Франция);

в) типа АНАЭРОтест 23 (PLIDA-Lachema diagnostica s.r.o., Чехия).



5.2.1. Аппаратура, материалы, лабораторная посуда, реактивы и питательные среды <*>

--------------------------------

<*> Допускается использование других аппаратуры, материалов, реактивов, питательных сред и диагностических тест-систем с аналогичными характеристиками, прошедших регистрацию в РФ в установленном порядке. При их применении необходимо руководствоваться рекомендациями изготовителя.



    А) аппаратура и инструментарий
Анализатор потенциометрический, погрешность измерений
pH +/- 0,01                                               ГОСТ 19881-74
Шкаф сушильный стерилизационный
ШСС-80П или других марок, позволяющий поддерживать
температуру (160 +/- 5) °С                                ТУ 64-1-28-70-76
Термостат, позволяющий поддерживать рабочую температуру
28 - 37 °С с отклонением от заданной +/- 1 °С             ТУ 64-1-1382-72
Баня водяная с подогревом                                 ГОСТ 12026-76
Весы лабораторные общего назначения 2 и 4 класса
точности с наибольшим пределом взвешивания 200 г          ГОСТ 24104-88
Микроскоп биологический МБИ-2, МБИ-3, МБР-3               ГОСТ 8284-78
Стерилизаторы паровые медицинские и аналогичные           ГОСТ 19569-89Е
Дистиллятор, обеспечивающий качество дистиллированной
воды в соответствии с                                     ГОСТ 6709-72
Облучатель бактерицидный настенный ОБН-150 или других
видов                                                     ТУ 16-535-84
Холодильник бытовой электрический
Пинцет медицинский                                        ГОСТ 21241-89
Ножницы медицинские                                       ГОСТ 21239-89
Скальпель хирургический, 15 см                            ГОСТ 21240-89
Микробиологические петли
Штативы для пробирок
Часы механические сигнальные                              ГОСТ 3145-84
Микроволновая печь
    Б) лабораторная посуда и материалы
Бумага фильтровальная лабораторная                        ГОСТ 12026-76
Бутыли стеклянные для химических реактивов
Кастрюли эмалированные                                    ГОСТ 24778-81
Марля медицинская                                         ГОСТ 9412-77
Колбы плоскодонные конические или круглые разной
вместимости                                               ГОСТ 1770-74
Воронки стеклянные                                        ГОСТ 25336-82
Вата медицинская гигроскопическая                         ГОСТ 5556-81
Полистироловые планшеты U-образные
Пробирки типов П1, П2                                     ГОСТ 25336-82
Стекла предметные для микропрепаратов                     ГОСТ 6672-75
Ступка фарфоровая с пестиком                              ГОСТ 9147-80
Термометр ртутный с диапазоном измерения от 0 до 100 °С
(цена деления шкалы 1 °С)                                 ГОСТ 13646-68
Чашки биологические (Петри)                               ГОСТ 23932-90
Книга-каталог кодов или комплект программного
обеспечения для идентификации
Бланки для регистрации результатов
Микробиологические петли
Фломастеры-маркеры
    В) реактивы и питательные среды
Агар микробиологический                                   ГОСТ 17206-84
Вода дистиллированная                                     ГОСТ 6709-72
D-глюкоза, ч                                              ГОСТ 6038-79
D-лактоза, 1-водная                                       ТУ 6-09-22-98-79
Натрий фосфорно-кислый однозамещенный, ч                  ГОСТ 4198-75
Натрий фосфорно-кислый двухзамещенный, хч                 ГОСТ 2493-75
Кислота соляная, хч                                       ГОСТ 3118-77
Натрий хлористый, хч                                      ГОСТ 4328-77
Масло иммерсионное для микроскопии                        ГОСТ 31739-78
Набор реактивов для окраски по Граму
Спирт этиловый ректификованный технический                ГОСТ 18300-87
Спирт этиловый ректификованный                            ГОСТ Р 51652-2000
Экстракт дрожжевой
Триптон
Антибиотики разных групп
Диски с антибиотиками.
    Реактивы    производства   разных   фирм,   прошедшие   государственную
регистрацию и разрешенные для использования в установленном порядке.
    Г) питательные среды
Среды для выращивания бифидобактерий, молочнокислых и     НД изготовителя
пропионовокислых бактерий: ГМС, М17, MRS, БС-среда (для
культивирования и выделения бифидобактерий, НИИ ПМ,
г. Оболенск)
    Д) тест-панели для идентификации культур
API-20CHL и API-50CHL                                     по спецификации
                                                          изготовителя
АНАЭРОтест 23                                             по спецификации
                                                          изготовителя
    Е) стандарт мутности по McFarland или ОСО.

Питательные среды и биологические препараты импортного производства должны иметь сертификат качества ИСО 9000 или EN 29 000.



5.2.2. Методика проведения биохимической идентификации штамма

Из чистой 18 - 24-часовой культуры готовят суспензию в стерильной дистиллированной воде. Суспензию тщательно гомогенизируют. Суспензию доводят до определенной мутности по шкале McFarland в зависимости от вида исследуемого штамма. Неправильно приготовленная суспензия (слишком густая или очень жидкая) может привести к получению ложных результатов.

Параллельно суспензию штамма или контрольного штамма высевают на питательные среды для проверки чистоты культуры, ее ростовых свойств и/или постановки дополнительных тестов.

Планшет для идентификации извлекают из упаковки и на прилагаемом к планшету бланке регистрируют номер испытуемого штамма и контрольного штамма.

Суспензию бактерий тщательно встряхивают и в каждую лунку инокулируют определенный объем суспензии (0,1 - 0,2 куб. см) в зависимости от требований фирмы-изготовителя и вида исследуемого штамма.

После инокуляции в ряд лунок может добавляться стерильное вазелиновое масло, полностью закрывающее внесенную суспензию клеток для создания анаэробных условий.

После инокуляции планшет накрывают крышкой и инкубируют 5 - 24 ч при оптимальной температуре для исследуемого вида (например, 42 °С - лактобациллы).

По окончании инкубации результаты учитывают визуально, отмечая цвет каждой лунки, и заносят в прилагаемые бланки.

В некоторые лунки (например, для ферментации индола) могут быть добавлены реактивы. Учет результатов на бета-галактозидазу проводят дважды: через 3 - 5 и 18 - 24 ч.

Идентификацию проводят с помощью таблиц, книг-каталогов кодов, компьютерного обеспечения соответствующих фирм-изготовителей, в заключении, учитывая данные, полученные по п. 5.1.1, указывают род и вид штамма.

Тестирование биохимических свойств используют для проверки стабильности фенотипических свойств штамма. Для этого культуру подвергают пассированию на жидких и плотных питательных средах и повторному через 3 - 5 пассажей тестированию биохимических свойств. Трехкратное совпадение всех исследованных биохимических реакций, выявленное при пассировании культур (не менее 10 пассажей), свидетельствует о стабильности фенотипических признаков. Вариабельность результатов по 1 - 2 реакциям свидетельствует о необходимости постановки дополнительных тестов на стабильность фено- и генотипических признаков штамма. Вариабельность результатов по большему числу реакций является свидетельством нестабильности фенотипических признаков и непригодности штамма для использования в пищевой промышленности.



5.3. Молекулярно-генетическое подтверждение таксономического статуса штаммов, установленного на основании фенотипических свойств

Для подтверждения таксономического положения штамма разработчик должен представить информацию об уровне его гомологии с штаммами этого вида, допущенными для использования в пищевой промышленности при создании аналогичной продукции. Разработчик (поставщик) должен представить информацию о нуклеотидной последовательности не менее двух локусов генома штамма, а также другие материалы, отражающие молекулярно-биологические характеристики.



5.3.1. Методика молекулярно-генетического анализа таксономической принадлежности бифидобактерий

    Принцип    метода.   Молекулярно-генетическая   идентификация   штаммов
молочнокислых   бактерий   базируется  на  определении  последовательностей
информационного  гена  16S рРНК и фрагментов операционных генов, кодирующих
ферменты  у  бифидобактерий. Поскольку филогения по 16S рРНК в значительной
степени  соотносится с эволюционной историей организмов, формируемые группы
по  последовательности  гена  16S рРНК, как правило, подтверждаются данными
анализов  фенотипических  свойств.  Для более детальной штаммоспецифической
идентификации   используется   подход   двухлокусного   секвенирования,   в
частности,   с   использованием   бета-субъединицы F F  АТФазы   или   гена
                                                    0 1
трансальдолазы [4] в случае отсутствия ПРЦ-фрагментов с  видоспецифическими
праймерами.


5.3.1.1. Оборудование, материалы, лабораторная посуда, реактивы <*>

--------------------------------

<*> Допускается использовать другие оборудование, материалы, лабораторную посуду, реактивы с аналогичными характеристиками, прошедшие регистрацию в РФ в установленном порядке.



А) аппаратура и инструментарий

Анаэростат для анаэробного выращивания микроорганизмов или система газогенераторная настольная;

Термостат суховоздушный;

Высокоскоростная микроцентрифуга;

Микротермостат "Термит";

Амплификатор типа "Терцик" или РТС-0150;

Камера для горизонтального электрофореза "SE-2";

Источник питания;

Трансиллюминатор ТСР-20 МС.

Б) питательные среды

Бульон и агар МРС с 0,5% цистеина.

В) реактивы и материалы

Трис HCl

ЭДТА

NaCl

Тритон-X100

Саркозил

Додецилсульфат натрия (SDS)

Фенол

Оксихинолин

Хлороформ

Изоамиловый спирт

Изопропанол

Этиловый спирт

Уксусная кислота, агароза, этидиум бромид, бромфеноловый синий, ксиленцианол, глицерин, лизоцим, РНКаза, протеиназа К, ДНК-маркер - ДНК фага лямбда/EcoRI+HindIII маркер ("Fermentas", Литва).

    Набор  "Амплификация": 10  х ПЦР  буфер, 2,5 mM SUM dNTPs, 50 mM MgCl ,
                                                                         2
фермент  Taq-полимераза  (5 ед./мкл),  минеральное  масло (Компания "Dialat
Ltd",  Россия);  набор для выделения фрагментов из агарозного геля QIAquick
Gel Extraction Kit (фирма "Qiagen").

5.3.1.2. Ход определения

1. Условия выращивания. Культуру бифидобактерий выращивают в высоких пробирках с 20 мл бульона в анаэростате в течение 48 ч при 37 °С.

2. Выделение геномной ДНК из Bifidobacterium. На данной стадии проведения анализа проба подвергается специальной обработке, в результате которой происходит лизис клеточного материала, удаление белковых и полисахаридных фракций и получение раствора ДНК или РНК, свободной от ингибиторов и готовой для дальнейшей амплификации. Выбор методики выделения ДНК (РНК) в основном определяется характером обрабатываемого материала. За основу взят метод выделения ДНК из клеток бифидобактерий Regnault B. et al. [5]; модифицированный метод разработан в лаборатории генетики микроорганизмов Института общей генетики им. Н.И. Вавилова РАН.

Методика выделения. Культуру бактерий центрифугировать при 8000 об./мин. в течение 10 мин. Осадок суспендировать в 0,6 мл буфера TEST (трис HCl pH 8,0 10 mM; ЭДТА pH 8,0 5 mM; NaCl 1 M; Тритон-X100 1/200 объема). Осторожно перемешать. Инкубировать при 37 °С в течение 12 ч. Добавить 150 мкл свежеприготовленного раствора лизоцима (исходная концентрация 100 мг/мл); добавить 10 мкл раствора РНКазы (исходный раствор 10 мг/мл). Осторожно перемешать. Инкубировать при 37 °С в течение 3 ч (суспензия должна стать слегка вязкой). Добавить 150 мкл раствора протеиназы К (исходный раствор 20 мг/мл) и 150 мкл 10%-ного саркозила. Осторожно перемешать. Инкубировать при 37 °С в течение 24 ч до полного лизиса. Добавить 100 мкл 25%-ного додецилсульфата натрия, перемешать, инкубировать при 55 °С в течение 2,5 ч (суспензия должна посветлеть). Очистку ДНК следует проводить в эппендорфах объемом 2 мл. К лизату клеток добавить 1 объем фенола (свежеперегнанный фенол предварительно насытить сначала трис HCl pH 8,0 1 M, а затем трис HCl pH 8,0 0,1 M, добавить оксихинолин). Содержимое эппендорфа интенсивно, но осторожно перемещать переворачиванием в течение 1 мин. Центрифугировать 10 мин. при 12000 об./мин. Водную фазу отобрать в новый эппендорф, обработку фенолом повторить. Водную фазу отобрать в чистый эппендорф и добавить 1 объем хлороформа с изоамиловым спиртом (24 хлороформа:1 изоамилового спирта). Содержимое эппендорфа перемещать переворачиванием в течение 1 мин. Центрифугировать 5 мин. при 12000 об./мин. Водную фазу перенести в чистый эппендорф, добавить 1 мл изопропанола, перемешать переворачиванием (появится осадок в виде тяжей). Центрифугировать в течение 1 мин. при 10000 об./мин., удалить супернатант. Осадок промыть 70%-ным этиловым спиртом, высушить и растворить в 150 мкл воды.

Учет результатов. Результаты исследования учитываются путем анализа исследуемых образцов методом электрофореза в агарозном геле.

    3.  Амплификация  ДНК  методом полимеразной цепной реакции (ПЦР). Метод
основан на многократном избирательном копировании определенного участка ДНК
при  помощи  ферментов  в  искусственных  условиях (in vitro) [6]. При этом
происходит  копирование только того участка, который удовлетворяет заданным
условиям,  и  только  в  том  случае,  если  он  присутствует в исследуемом
образце.  ПЦР позволяет найти в исследуемом клиническом материале небольшой
участок генетической информации (несколько десятков пар нуклеотидов ДНК или
РНК)  любого организма, содержащийся в следовых количествах среди огромного
количества   нуклеотидных   последовательностей   иной  природы,  и  быстро
размножить  его.  По  сути дела метод ПЦР имитирует в пробирке естественную
репликацию  ДНК,  только  повторяющуюся с огромной скоростью и столько раз,
сколько   это  необходимо  исследователю.  Специфичность  ПЦР  основана  на
образовании  комплементарных  комплексов  между  матрицей  и  праймерами  -
короткими синтетическими олигонуклеотидами длиной 18 - 30 оснований. Каждый
из праймеров комплементарен одной из цепей двухцепочечной матрицы, обрамляя
начало  и  конец  амплифицируемого  участка.  После  гибридизации матрицы с
праймером  (отжиг)   последний  служит  затравкой  для  ДНК-полимеразы  при
синтезе  комплементарной цепи матрицы. Важнейшая характеристика праймеров -
температура плавления (T ) комплекса праймер-матрица. Она определяется  как
                        m
температура,  при которой праймер присоединился к половине возможных сайтов
связывания. T  можно приблизительно определить по формуле:
             m


                    T  = 2 х (n  + n ) + 4 х (n  + n ),
                     m         A    T          G    C


    где  n  - количество нуклеотидов X в праймере.  Если праймер короткий и
          X
T  мала, то праймер может оказаться частично комплементарен другим участкам
 m
матричной  ДНК,  что  может привести к появлению неспецифических продуктов.
Верхний   предел  температуры  плавления  ограничен  оптимумом  температуры
действия полимеразы, активность которой падает при температурах выше 80 °С.

Обычно при проведении ПЦР выполняется 20 - 35 циклов, каждый из которых состоит из трех стадий: 1. Денатурация. Двухцепочечную ДНК-матрицу нагревают до 94 - 96 °С (или до 98 °С, если используется особенно термостабильная полимераза) на 0,5 - 2 мин., чтобы цепи ДНК разошлись. 2. Отжиг. Когда цепи разошлись, температуру понижают, чтобы праймеры могли связаться с одноцепочечной матрицей. Эта стадия называется отжигом. Температура отжига зависит от состава праймеров и обычно выбирается на 4 - 5 °С ниже их температуры плавления. Время стадии - 0,5 - 2 мин. 3. Элонгация. ДНК-полимераза реплицирует матричную цепь, используя праймер в качестве затравки. Это - стадия элонгации. Полимераза начинает синтез второй цепи от 3'-конца праймера, который связался с матрицей, и движется вдоль матрицы. Температура элонгации зависит от полимеразы. Часто используемые полимеразы Taq и Pfu наиболее активны при 72 °С. Время элонгации зависит как от типа ДНК-полимеразы, так и от длины амплифицируемого фрагмента. Обычно время элонгации принимают равным одной минуте на каждую тысячу пар оснований. После окончания всех циклов часто проводят дополнительную стадию финальной элонгации, чтобы достроить все одноцепочечные фрагменты. Эта стадия длится 7 - 10 мин.

    Подготовка  к  анализу.  Состав смеси для ПЦР (на 100 мкл): 10 мкл 10 х
ПЦР  буфера,  10 мкл  смеси  2,5 mM  SUM dNTPs,  4 мкл  50 mM MgCl , 300 нг
                                                                  2
геномной ДНК и 0,8 мкл фермента Tag-полимеразы. Олигонуклеотидные  праймеры
добавляют в концентрации 20 пмоль на 100 мкл смеси.

Проведение исследования. Параметры ПЦР реакции: денатурация геномной ДНК при 95 °С в течение 5 мин.; затем 30 циклов амплификации: 94 °С в течение 1 мин. (денатурация), 56 - 58 - 60 °С (в зависимости от праймеров) в течение 1 мин. (отжиг олигонуклеотидов), 72 °С в течение 2 мин. (достройка (элонгация) цепи); финальная элонгация фрагментов при 72 °С в течение 10 мин., хранение при 4 °С.

4. Праймеры, используемые для идентификации рода и вида бифидобактерий, приведены в табл. 1 и 2.



Таблица 1



-----------------+-----------------+-------------------------+-------------
¦ Название рода, ¦    Название     ¦Структура олигонуклеотида¦ Ожидаемый  ¦
¦      вида      ¦ олигонуклеотида ¦          5'-3'          ¦ размер ПЦР ¦
¦                ¦                 ¦                         ¦ фрагмента, ¦
¦                ¦                 ¦                         ¦ нуклеотиды ¦
+----------------+-----------------+-------------------------+------------+
¦       1        ¦        2        ¦            3            ¦     4      ¦
+----------------+-----------------+-------------------------+------------+
¦Bifidobacterium ¦g-Bifid-1        ¦CTCCTGGAAACGGGTGG        ¦549 - 563   ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦g-Bifid-2        ¦GGTGTTCTTCCCGATATCTACA   ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. adolescentis ¦BiADOg-1a-1      ¦CTCCAGTTGGATGCATGTC      ¦279         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiADOg-1b-1      ¦TCCAGTTGACCGCATGGT       ¦            ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiADO-2          ¦CGAAGGCTTGCTCCCAGT       ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. angulatum    ¦BiANG-1          ¦CAGTCCATCGCATGGTGGT      ¦275         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiANG-2          ¦GAAGGCTTGCTCCCCAAC       ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. breve        ¦BiBRE-1          ¦CCGGATGCTCCATCACAC       ¦288         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiBRE-2          ¦ACAAAGTGCCTTGCTCCCT      ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. catenulatum  ¦BiCATg-1         ¦CGGATGCTCCGACTCCT        ¦285         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiCATg-2         ¦CGAAGGCTTGCTCCCGAT       ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. bifidum      ¦BiBIF-1          ¦CCACATGATCGCATGTGATTG    ¦278         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiBIF-2          ¦CCGAAGGCTTGCTCCCAAA      ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. infantis     ¦BiINF-1          ¦TTCCAGTTGATCGCATGGTC     ¦828         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiINF-2          ¦GGAAACCCCATCTCTGGGAT     ¦            ¦
+----------------+-----------------+-------------------------+------------+
¦B. longum       ¦BiLON-1          ¦TTCCAGTTGATCGCATGGTC     ¦831         ¦
¦                +-----------------+-------------------------+            ¦
¦                ¦BiLON-2          ¦GGGAAGCCGTATCTCTACGA     ¦            ¦
-----------------+-----------------+-------------------------+-------------


Таблица 2



-----------------+----------------------------+-------------------
¦    Название    ¦ Структура олигонуклеотида  ¦ Ожидаемый размер ¦
¦олигонуклеотида ¦           5'-3'            ¦    фрагмента,    ¦
¦                ¦                            ¦    нуклеотиды    ¦
+----------------+----------------------------+------------------+
¦                Для амплификации генов 16S рРНК                 ¦
+----------------+----------------------------+------------------+
¦16SN            ¦GTGGAGGGTTCGATTCTGGCT       ¦1550              ¦
+----------------+----------------------------+                  ¦
¦16SC            ¦AGAAAGGAGGTGATCCAGCCG       ¦                  ¦
+----------------+----------------------------+------------------+
¦       Для амплификации генов бета-субъединиц F F  АТФаз        ¦
¦                                               0 1              ¦
+----------------+----------------------------+------------------+
¦BLбетаN         ¦ATGGCTGACAACCAGACCACT       ¦1550              ¦
+----------------+----------------------------+                  ¦
¦BLбетаC         ¦TCACGCACCCAGTTCCTTCTG       ¦                  ¦
+----------------+----------------------------+------------------+
¦              Для амплификации гена трансальдолазы              ¦
+----------------+----------------------------+------------------+
¦BtalFor         ¦CGTCGCCTTCTTCTTCGTCTC       ¦301               ¦
+----------------+----------------------------+                  ¦
¦BtalRev         ¦CTTCTCCGGCATGGTGTTGAC       ¦                  ¦
-----------------+----------------------------+-------------------


5. Визуализация результатов методом электрофореза в агарозном геле. Результаты исследования учитываются путем анализа продуктов амплификации исследуемых образцов методом электрофореза в агарозном геле. В результате амплификации должны быть наработаны фрагменты, соответствующие размерам, указанным в табл. 1 и 2.

Для разделения фрагментов ДНК по размеру (длине) применяют метод ДНК-электрофореза в агарозном геле [7]. Силы электрического поля, прикладываемого к образцам, заставляют фрагменты ДНК мигрировать через гель. Сахарофосфатный остов молекул ДНК заряжен отрицательно, и поэтому цепи ДНК двигаются от катода, заряженного отрицательно, к положительному аноду. Более длинные молекулы мигрируют медленнее, так как задерживаются в геле, более короткие молекулы двигаются быстрее. После разделения (краситель вносят в расплавленную агарозу) фрагменты ДНК разной длины визуализируют при помощи флюоресцентных красителей, специфично взаимодействующих с ДНК, например, агарозные гели обычно красят бромистым этидием, который интеркалирует между азотистыми основаниями дуплекса и флюоресцирует в УФ-лучах. Определение размеров производят путем сравнения полученных фрагментов с коммерчески доступными препаратами ДНК (ДНК-маркерами), содержащими линейные фрагменты ДНК известной длины.

Подготовка к анализу

А. Приготовление агарозного геля: 0,8 - 2,0%-ную суспензию агарозы в буфере для электрофореза доводят до кипения и охлаждают до 45 °С, добавляют этидиум бромид до концентрации 0,5 мкг/мл. Заливают в специальную форму с гребенкой и дают затвердеть, гребенку осторожно вынимают и форму с гелем переносят в аппарат для горизонтального электрофореза и погружают в буфер.

Б. Приготовление 1 л 10-кратного ТАЕ буфера для электрофореза: навеску 4,04 г Трис растворяют в 200 мл дистиллированной воды, добавляют 1,14 мл ледяной уксусной кислоты и 2 мл 0,5 M раствора ЭДТА pH 8,0 и доводят объем буфера до 1000 мл дистиллированной водой. Для проведения электрофореза 10-кратный ТАЕ буфер разводят дистиллированной водой в 10 раз.

Проведение исследования

В пробирки с исследуемыми образцами после завершения амплификации вносят аккуратно под масло 1/5 объема раствора, содержащего 0,25% раствора бромфенолового синего и 0,25% раствора ксиленцианола в 50%-ном глицерине, перемешивают наконечником для пипеточных дозаторов и 8 мкл полученного образца вносят в лунки агарозного геля, образовавшиеся от зубцов гребенки. Электрофорез проводят при напряжении 120 вольт в течение 60 мин. За это время краситель успевает пройти не менее половины геля.

Учет результатов электрофореза. Результаты электрофореза учитывают в ультрафиолетовом свете с длиной волны 254 нм на приборе "Трансиллюминатор". Результаты реакции выявляются в виде светящихся красноватых полос. Положительными считаются пробы, содержащие фрагменты необходимой длины (1550 нуклеотидов).

6. Выделение и очистка амплифицированной ДНК. Проводят с использованием наборов для выделения фрагментов из агарозного геля (типа QIAquick Gel Extraction Kit фирмы "Qiagen") согласно протоколу изготовителя.

    7.   Определение   нуклеотидных  последовательностей  генов  16S  рРНК,
трансальдолазы  и  бета-субъединицы F F  АТФазы. Проводят по методу Сэнгера
                                     0 1

[8].

Анализ таксономической принадлежности бифидобактерий проводят с использованием компьютерной программы Blast (http://www.ncbi.nlm.nih.gov/blast). Для сравнения последовательностей генов рибосомальных РНК у бифидобактерий используют последовательности этого гена, характерные для разных видов Bifidobacterium, депонированные в GenBank NCBI. Сравнение последовательностей проводят с использованием программы ClustalW (http://www.ch.embnet.org/software/ClustalW.html).



5.3.2. Методика молекулярно-генетического анализа таксономической принадлежности лактобактерий

5.3.2.1. Сравнительный анализ нуклеотидных последовательностей генов 16S рРНК для идентификации видовой принадлежности Lactobacillus spp.

Сущность метода. Секвенированием ДНК называют комплекс методов, позволяющих определить нуклеотидную последовательность ДНК или ее фрагментов. Для идентификации и классификации бактерий определяют нуклеотидную последовательность наиболее консервативных участков бактериального генома. Изучение полных нуклеотидных последовательностей отдельных генов дает дополнительную информацию об эволюции таксона. Родственные представители обычно обладают гомологичными по последовательности генами. Поэтому на данный момент таксономия базируется в основном на данных секвенирования малой субъединицы рРНК как наиболее информационном виде анализа (Ботина и др., 2005, 2007).

5.3.2.2. Оборудование, материалы, лабораторная посуда, реактивы.

А. Реактивы:

50 мМ Трис-HCl

    10 мМ ЭДТА-Na
                 2

хлороформ

лизоцим

РНКаза

10% SDS

5 М NaCl

фенол

изопропанол

деионизированная вода

Taq-полимераза

праймеры (фирма "Синтол")

агароза.

Б. Оборудование:

термостатный бокс для выращивания микроорганизмов

центрифуга

центрифуга вортекс

водяная баня

амплификатор Omn-E фирмы Hybaid

камера для электрофореза.

5.3.2.3. Выделение ДНК

Выращивание всех штаммов лактобактерий проводят в жидкой стандартной среде МРС при 37 °С в течение 24 - 48 ч.

    Клетки  из  14  мл  культуры  осаждают  центрифугированием при 4400 g в
течение  12  мин.  и  ресуспендируют  в  7  мл буфера 50 мМ Трис-HCl, 10 мМ
ЭДТА-Na ,  pH  8,0.  Суспензию  клеток  центрифугируют  в тех же условиях и
       2
осадок ресуспендируют в 500 мкл указанного выше буфера; суспензию переносят
в 2-мл центрифужную пробирку и добавляют 50 мкл хлороформа. Смесь энергично
встряхивают  с помощью вортекса (5 раз по 10 сек.), вносят 100 мкл лизоцима
(60  мг/мл)  и инкубируют 30 мин. при 37 °С; затем добавляют 6 мкл РНКазы А
(10  мг/мл) и инкубируют еще 30 мин. при 37 °С. Для лизиса клеток суспензию
мягко  смешивают  с  200  мкл  10%  ДСН  (SDS)  и  200  мкл 5 М NaCl; смесь
инкубируют  16  ч  при  65  °С.  Полученный грубый лизат клеток остужают до
комнатной  температуры,  добавляют  1  мл  смеси  фенол/хлороформ  (1:1)  и
тщательно  смешивают  в  течение  5  мин. до состояния гомогенной эмульсии;
смесь  центрифугируют  при  12000  g  15  мин. Водную фазу, содержащую ДНК,
отбирают  в новую 1,5-мл пробирку и смешивают с 600 мкл изопропанола. Смесь
инкубируют  30  мин. при комнатной температуре и центрифугируют при 12000 g
20  мин.  Осадок  ДНК  трижды промывают порциями по 0,5 мл 75%-ного этанола
(центрифугирование  по  5  мин.  при  12000  g)  и  растворяют  в  100  мкл
деионизованной воды. ДНК хранят при -20 °С.

5.3.2.4. Анализ 16S рибосомной нуклеиновой кислоты.

1. Полимеразная цепная реакция (ПЦР)

    Гены  16S  рРНК  амплифицируют с помощью ПЦР с использованием праймеров
27f  (AGAGTTTGATCCTGGCTCAG)  и  1492r  (GGTTACCTTGTTACGACTT)  [Lane, 1991].
Каждую  реакцию  проводят  в  50  мкл реакционной смеси, содержащей 0,5 мкг
хромосомной ДНК, по 20 пмоль праймеров, 200 мкМ каждого dNTP, 1,5 мМ MgCl ,
                                                                         2
50   мМ   KCl,   10   мМ  Tris-HCl  (pH  8,8)  и  1,25  единицы  активности
Taq-полимеразы.  Реакцию  проводят  в  амплификаторе  Omn-E  фирмы  Hybaid.
Сначала образцы ДНК подвергают денатурации при 94 °С в течение 5 мин. Затем
проводят  35  циклов,  включающих денатурацию ДНК при 94 °С в течение 30 с,
отжиг праймеров при температуре 55 °С в течение 40 с и полимеразную реакцию
в течение 1 мин. Заключительный этап элонгации проводят при 72 °С в течение
4  мин.  Праймеры  для  ПЦР  синтезируются  по  предварительному  заказу  в
специализированном предприятии (ООО "Синтол", РФ).

2. Электрофорез ДНК в агарозном геле и выделение ДНК из геля

    Гель-электрофорез ДНК проводят в горизонтальном 0,7%-ном агарозном геле
в  трис-ацетатном  буфере  при  напряженности  электрического  поля 5 В/см,
содержащем   0,5  мкг/мл   бромистого   этидия.  Для  определения  размеров
                                                                         TM
фрагментов ДНК в качестве стандартов используют ДНК-маркер типа GeneRuler
DNA Ladder Mix SM0331 фирмы Fermentas.

Фрагменты ДНК выделяют из геля методом электроэлюции на полоску DEAE бумаги Serva. Бумагу вставляют перед полосой фрагмента в прорезь в геле и проводят электрофорез в течение 7 мин. при 10 вольт/см. Бумагу со связавшейся с ней ДНК помещают в 500 мкл 2 М раствора NaCl и инкубируют 40 мин. при 65 °С. После удаления бумаги ДНК осаждают из раствора 1 мл 96%-ного этанола. Осадок ДНК промывают 2 раза 70%-ным этанолом и растворяют в 40 мкл буфера ТЕ.

3. Секвенирование ДНК

    Секвенирование   фрагментов   ДНК   проводится   в   специализированном
предприятии  на  базе  Центра  коллективного  пользования "Геном" (Институт
молекулярной биологии им. В.А. Энгельгардта РАН) с помощью набора реактивов
                     TM
ABI  PRISM(R)  BigDye    Terminator v. 3.1 с последующим анализом продуктов
реакции   на   автоматическом   секвенаторе  ДНК  ABI  PRISM  3730  Applied
Biosystems.

4. Анализ нуклеотидных последовательностей генов 16S рРНК

С целью идентификации видовой принадлежности исследуемые последовательности ДНК анализируют на сходство с известными последовательностями генов 16S рРНК в базе данных GeneBank с помощью программы BLASTN (http://blast.ncbi.nlm.nih.gov/Blast.cgi) [Zhang et al., 2000].

Идентичность последовательностей устанавливают на основе статистической значимости совпадений последовательностей. Дополнительный анализ последовательностей проводят с помощью их выравнивания с использованием программы Clustal X (http://www.ebi.ac.uk/Tools/clustalw/index.html).



6. Методы исследования биологических свойств пробиотических штаммов

Санитарно-эпидемиологическая оценка штаммов должна базироваться на обязательных характеристиках безопасности и потенциальных пробиотических свойств видов культур, указанных в п. 2.3 настоящих методических указаний, а также на дополнительных характеристиках, получение которых является необходимым для определенных изучаемых микроорганизмов.

Дополнительное тестирование проводится в случаях, если: а) штаммы относятся к видам, среди представителей которых известно о наличии болезнетворных для человека штаммов, б) - у штамма наряду со способностью улучшать состав и биологическую активность микрофлоры ЖКТ или помимо таковой предполагается наличие дополнительной (специфической) функциональной активности.



6.1. Основные методы исследования безопасности штаммов в тестах in vitro

6.1.1. Определение фенотипического профиля чувствительности/резистентности штамма к антимикробным препаратам

Чувствительность/резистентность штаммов к антимикробным препаратам определяют диско-диффузионным методом (ДДМ) с наложением стандартных бумажных дисков, пропитанных антимикробными препаратами, на поверхность плотной среды и/или методом серийного разведения антибиотика в жидкой питательной среде. Метод основан на способности антимикробных препаратов, диффундирующих в питательную среду, угнетать рост микроорганизмов, посеянных на поверхности агара, вокруг дисков с образованием зон задержки роста, или подавлять рост микробов в жидкой среде с внесенными в нее различными концентрациями препаратов. В этом случае для характеристики чувствительности штаммов к антимикробным препаратам устанавливают минимальную ингибирующую концентрацию (МИК), при которой отсутствует видимый рост культуры. Эта концентрация определяет степень чувствительности штамма к антибиотику.

Для оценки следует использовать не менее 25 - 30 наименований из числа основных употребляемых в медицине групп антимикробных препаратов (пенициллины, цефалоспорины 1 и 3 поколений, карбапинемы, аминогликозиды 1, 2, 3 поколений, тетрациклины, макролиды, линкозамины, гликопептиды, полимиксины, хинолоны и фторхинолоны).

А. Тестирование бифидобактерий диско-диффузионным методом

Используют модифицированный в лаборатории биологии бифидобактерий ФГУН "Московский научно-исследовательский институт эпидемиологии и микробиологии им. Габричевского" диско-диффузионный метод на основе МУК 4.2.1890-04 "Определение чувствительности микроорганизмов к антибактериальным препаратам" и рекомендаций Национального Комитета Клинических Лабораторных Стандартов, NCCL, 2002 г., США. Используют диски с антибиотиками производства НИИЭМ им. Пастера (Россия, Санкт-Петербург).

    Бактериальную     культуру     готовят    общепринятым    методом    из
лиофилизированного   материала.  Третью  генерацию  бульонной  культуры  из
              -4
разведения  10    в  количестве 0,1 мл наносят на поверхность агаризованной
БС-среды  для  культивирования  и выделения бифидобактерий производства НИИ
прикладной  микробиологии,  г.  Оболенск,  разлитой  в чашки Петри слоем не
меньше  4  -  5  мм  непосредственно  перед  постановкой  опыта.  Круговыми
движениями  шпателя  быстро  равномерно  втирают  материал  в агаризованную
среду,   раскладывают  антибиотики  по  трафарету  (не  более  5  дисков  с
антибиотиками на чашку), с учетом зон задержки роста культур для каждого из
антибиотиков   (зоны   оценивали  в  предварительном  эксперименте).  Чашки
помещают  в  анаэростаты  с  атмосферой,  содержащей  10% CO , генерируемой
                                                            2
газпаками  фирмы  Биомерье.  Учет зон задержки роста бактериальной культуры
проводят через 24 ч выращивания при (37,5 +/- 1) °С.

Интерпретацию полученных результатов проводят при использовании пограничных значений чувствительности бифидобактерий, разделяющих их на три категории, установленных в табл. 2.



Таблица 2



КРИТЕРИИ ИНТЕРПРЕТАЦИИ РЕЗУЛЬТАТОВ ДЛЯ ОЦЕНКИ ЧУВСТВИТЕЛЬНОСТИ БИФИДОБАКТЕРИЙ [ПО ЖИЛЕНКОВОЙ О.Г., АМЕРХАНОВОЙ А.М., 2009; НАЗЫРОВОЙ Н.Р., 2008]

----------------+--------+----------------------------------------
¦   Препарат    ¦  Доза  ¦  Диаметр зоны ингибиции роста, мм, и  ¦
¦               ¦вещества¦      категории чувствительности       ¦
¦               ¦в диске,¦            бифидобактерий             ¦
¦               ¦  мкг   +-----------+------------+--------------+
¦               ¦        ¦устойчивые ¦промежуточно¦чувствительные¦
¦               ¦        ¦           ¦ устойчивые ¦              ¦
+---------------+--------+-----------+------------+--------------+
¦       1       ¦   2    ¦     3     ¦     4      ¦      5       ¦
+---------------+--------+-----------+------------+--------------+
¦Доксициклин    ¦30      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Полимиксин     ¦300     ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Стрептомицин   ¦10      ¦<= 16      ¦17 - 19     ¦>= 20         ¦
+---------------+--------+-----------+------------+--------------+
¦Гентамицин     ¦10      ¦<= 12      ¦13 - 14     ¦>= 15         ¦
+---------------+--------+-----------+------------+--------------+
¦Тетрациклин    ¦30      ¦<= 16      ¦17 - 21     ¦>= 22         ¦
+---------------+--------+-----------+------------+--------------+
¦Ципрофлоксацин ¦5       ¦<= 15      ¦16 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Пенициллин     ¦10      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Цефалоспорин   ¦30      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Карбапинем     ¦10      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Линкомицин     ¦15      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Ванкомицин     ¦30      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Эритромицин    ¦15      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Хлорамфеникол  ¦30      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Имипенем       ¦10      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Ампициллин     ¦10      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
+---------------+--------+-----------+------------+--------------+
¦Цефалотин      ¦30      ¦<= 8 - 10  ¦11 - 20     ¦>= 21         ¦
----------------+--------+-----------+------------+---------------


Б. Тестирование лактобактерий диско-диффузионным методом

Используют агаризованную питательную среду МРС, которую вносят в чашки диаметром 90 мм в объеме 20 мл для достижения слоя агара (4,0 +/- 0,5) мм.

    Из  тестируемых культур готовят суспензии, соответствующие по плотности
оптическому  стандарту  мутности  на  5 единиц (с содержанием микробных тел
Страницы документа: 1 2 3 4 5

Комментарии
Комментирование через социальные сервисы Facebook и Вконтакте:

Курсы валют ЦБР

02.04.201503.04.2015
EUR62.747661.6919
USD58.353656.9902
UAH2.499082.42511
KZT0.3142360.306754
GBP86.526784.5564
CNY9.414459.19642
JPY0.4859970.476646

Интересные новости